Approximate Pattern Matching Problem: Find all approximate occurrences of a pattern in a string.     Input: Strings Pattern and Text along with an integer d.
     Output: All starting positions where Pattern appears as a substring of Text with at most d mismatches.

CODE CHALLENGE: Solve the Approximate Pattern Matching Problem.

Решено. Пример сходится. Квиз не принимается О_о

def hamdist(str1, str2):
 
       
        diffs = 0
        for ch1, ch2 in zip(str1, str2):
                if ch1 != ch2:
                        diffs += 1
        return diffs

def  Approximate_Pattern(Pattern, Genome, d):
       pos = []
       for i in range(len(Genome) - len(Pattern) ):
              if hamdist(Genome[i:i+len(Pattern)], Pattern) <= d:
                    pos.append(str(i))
       return " ".join(pos)



print  (Approximate_Pattern("ATTCTGGA", "CGCCCGAATCCAGAACGCATTCCCATATTTCGGGACCACTGGCCTCCACGGTACGGACGTCAATCAAAT", 3))